cuSBF is a high-performance GPU implementation of the Super Bloom filter, optimized for high-throughput batch k-mer insertion and query on nucleotide (DNA) and protein sequences (or any other sequence type as long as a valid alphabet is provided).
It exploits the streaming nature of sequence-derived k-mers by using minimizers to group consecutive k-mers sharing the same minimiser into super-k-mers, assigning all k-mers of a super-k-mer to the same 256-bit memory shard. This amortizes random memory accesses across consecutive k-mer queries, reducing memory-bandwidth pressure. The findere scheme further reduces false positives dramatically by inserting overlapping s-mers and requiring a full run of consecutive s-mer matches.
- CUDA-accelerated batch k-mer insert and query from sequences
- Configurable k-mer length, minimiser width, s-mer width, and hash function count
- Minimizer-based shard selection for cache-efficient streaming queries
- Findere false-positive reduction via overlapping s-mer membership
- Header-only library design
- FASTA/FASTQ stream and file support
Benchmarks use Config<31, 28, 16, 4> on an NVIDIA RTX PRO 6000 Blackwell GPU. CPU Super Bloom runs on an Intel Xeon W9-3595X with 120 threads.
Compared against:
- CPU Super Bloom
- GPU Blocked Bloom filter (GBBF)
- GPU Cuckoo-GPU
- GPU Bulk Two-Choice Filter (TCF)
- GPU Counting Quotient Filter (GQF)
| Comparison | Insert | Query |
|---|---|---|
| cuSBF vs Super Bloom | 92× faster | 234× faster |
| cuSBF vs GBBF | 9.1× faster | 7.7× faster |
| cuSBF vs Cuckoo-GPU | 80× faster | 8.0× faster |
| cuSBF vs TCF | 12× faster | 52× faster |
| cuSBF vs GQF | 69× faster | 13× faster |
| Comparison | Insert | Query |
|---|---|---|
| cuSBF vs Super Bloom | 59× faster | 165× faster |
| cuSBF vs GBBF | 8.2× faster | 7.6× faster |
| cuSBF vs Cuckoo-GPU | 3427× faster | 7.8× faster |
| cuSBF vs TCF | 12× faster | 67× faster |
| cuSBF vs GQF | 42× faster | 11× faster |
| Bits/k-mer | cuSBF s=28 |
cuSBF s=30 |
cuSBF s=31 |
GBBF |
|---|---|---|---|---|
| 21.4 | 0.848% | 0.951% | 1.593% | 3.069% |
| 85.7 | 0.091% | 0.107% | 0.210% | 0.126% |
| 342.6 | 0.0095% | 0.0114% | 0.0264% | 0.0273% |
- Linux (x86_64 or aarch64) with an NVIDIA GPU and driver
- CUDA Toolkit >= 13.1
- GCC or Clang host compiler (C++20)
- Meson and Ninja
- NVIDIA GPU with compute capability 8.0+ (Ampere, Lovelace, Hopper, Blackwell)
cuSBF is developed and tested on Linux only.
- WSL2 on Windows with is a reasonable dev environment (See NVIDIA docs).
- Native Windows and macOS are not supported or tested. The build uses Linux-specific FASTX paths (for example
mmap) and host tooling assumptions (GCC/Clang, GNU statement expressions inCUSBF_TRY/CUSBF_UNWRAP).
meson setup build
ninja -C buildWhen this repo is the root Meson project, benchmarks, tests, and examples build by default. As a subproject they are skipped unless you force them on.
| Option | Type | Default | Description |
|---|---|---|---|
benchmarks |
feature | auto |
Google Benchmark binaries |
tests |
feature | auto |
GoogleTest suite |
examples |
feature | auto |
Example CLI |
param_sweep |
feature | disabled |
Parameter-sweep binaries (large, see below) |
param_sweep_alphabet |
combo | dna |
dna or protein when param_sweep is enabled |
large_fastx_tests |
feature | disabled |
Large generated FASTX test (CUSBF_LARGE_FASTX_* env vars) |
Each feature option accepts auto, enabled, or disabled:
auto— on for a standalone checkout, off when cuSBF is a subprojectenabled/disabled— override regardless of project layout
Important
Enabling param_sweep builds many binaries (208 for the DNA alphabet). Leave it disabled unless you need that sweep.
# Default standalone build
meson setup build
# Faster configure: library + examples only
meson setup build -Dbenchmarks=disabled -Dtests=disabled
# Subproject consumer forcing tests on
meson setup build -Dtests=enabled
# Parameter sweep
meson setup build -Dparam_sweep=enabled
meson setup build -Dparam_sweep=enabled -Dparam_sweep_alphabet=proteinFallible APIs return cusbf::Result<T> (a thin wrapper over cuda::std::expected<T, Error>). Use return Err(error) (cuda::std::unexpected<Error>, deduces Result<T>) or return Ok() / return {} for Result<void>. For success with a value, return value is enough. Two helpers unwrap results:
| Macro | On failure | Use when |
|---|---|---|
CUSBF_TRY(expr) |
Copies the error, then return cuda::std::unexpected<Error>(...) from the enclosing function |
The caller returns Result (library glue, examples/cusbf-main) |
CUSBF_UNWRAP(expr) |
throw std::runtime_error(message()) |
Tests, main, or other code that does not return Result |
Both work as statements or in initializers (auto x = CUSBF_UNWRAP(...)). For full control (typed errors, exit codes), use if (!result) instead.
#include <cusbf/filter.cuh>
using Config = cusbf::Config<31, 28, 16, 4>;
int main() {
cusbf::filter<Config> filter(1 << 24);
CUSBF_UNWRAP(filter.insert_sequence("ACGTACGTACGTACGTACGTACGTACGTACGT"));
const auto hits = CUSBF_UNWRAP(filter.contains_sequence("ACGTACGTACGTACGTACGTACGTACGTACGT"));
CUSBF_UNWRAP(filter.insert_fastx_file("reference.fasta"));
const auto summary = CUSBF_UNWRAP(filter.query_fastx_file("queries.fastq"));
(void)hits;
(void)summary;
return 0;
}When the caller already returns Result, use CUSBF_TRY so failures propagate without exceptions:
[[nodiscard]] cusbf::Result<void> run(cusbf::filter<Config>& filter) {
CUSBF_TRY(filter.insert_fastx_file("reference.fasta"));
const auto summary = CUSBF_TRY(filter.query_fastx_file("queries.fastq"));
(void)summary;
return cusbf::Ok();
}Async device APIs, record batches, and streaming FASTX callbacks follow the same pattern. filter.load_factor() and filter.filter_bits() are synchronous and do not return Result.
if (const auto result = filter.query_fastx_file("queries.fastq"); !result) {
const cusbf::Error& err = result.error();
std::cerr << err.message() << '\n';
if (const cusbf::FastxParseError* parse = err.as_fastx_parse()) {
// parse->location.file / .line / .column
}
return 1;
}CUSBF_CUDA_TRY wraps CUDA runtime calls into Result<void>; CUSBF_CUDA_CALL / CUSBF_CUDA_ABORT are for throw/abort paths only.
The Config template accepts the following parameters:
| Parameter | Description | Default |
|---|---|---|
K |
k-mer length (max depends on alphabet) | - |
S |
s-mer width for findere Bloom hash seed (1-K) | - |
M |
Minimiser width for shard selection (1-K) | - |
HashCount |
Number of independent Bloom hash functions (4,8,12,16) | 4 |
CudaBlockSize |
CUDA threads per block | 256 |
Alphabet |
Symbol encoding (DNA or protein) | DnaAlphabet |
#include <cusbf/filter.cuh>
using ProteinConfig = cusbf::Config<12, 10, 6, 4, 256, cusbf::ProteinAlphabet>;
[[nodiscard]] cusbf::Result<void> run_protein() {
cusbf::filter<ProteinConfig> filter(1 << 24);
CUSBF_TRY(filter.insert_sequence("ACDEFGHIKLMNPQRSTVWY"));
const auto hits = CUSBF_TRY(filter.contains_sequence("ACDEFGHIKLMNPQRSTVWY"));
(void)hits;
return cusbf::Ok();
}